Online Inquiry
PPP1R3F Knockout Cell Line
SPL-02738
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 154bp insertion |
| Target Information | |
|---|---|
| Target Name | PPP1R3F |
| Gene Abbr. | PPP1R3F |
| Gene ID | 89801 |
| Full Name | protein phosphatase 1 regulatory subunit 3F |
| Alias | HB2E, LL0XNC01-7P3.1, R3F |
| Species | Human |
| Genomic Locus | chrX:49285852 |
| Transcript | NM_033215 |
| WT Expression Level | 1.37 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes a protein that has been identified as one of several type-1 protein phosphatase (PP1) regulatory subunits. One or two of these subunits, together with the well-conserved catalytic subunit, can form the PP1 holoenzyme, where the regulatory subunit functions to regulate substrate specificity and/or targeting to a particular cellular compartment. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2010]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 154bp insertion in a coding exon of PPP1R3F. |
| Description | 154bp insertion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | ACTGGCAACCCCGCAGAAGA |
| PCR Primer |
Forward: TTTTATATAGAAACCCCTGTGGGGC Reverse: ATTCTCACTCGATACTCCCCATGT |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.