Online Inquiry
PPP1R3D Knockout Cell Line
SPL-02737
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 2bp deletion |
| Target Information | |
|---|---|
| Target Name | PPP1R3D |
| Gene Abbr. | PPP1R3D |
| Gene ID | 5509 |
| Full Name | protein phosphatase 1 regulatory subunit 3D |
| Alias | PPP1R6 |
| Species | Human |
| Genomic Locus | chr20:59939416 |
| Transcript | NM_006242 |
| WT Expression Level | 2.93 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | Phosphorylation of serine and threonine residues in proteins is a crucial step in the regulation of many cellular functions ranging from hormonal regulation to cell division and even short-term memory. The level of phosphorylation is controlled by the opposing actions of protein kinases and protein phosphatases. Protein phosphatase 1 (PP1) is 1 of 4 major serine/threonine-specific protein phosphatases which have been identified in eukaryotic cells. PP1 associates with various regulatory subunits that dictate its subcellular localization and modulate its substrate specificity. Several subunits that target PP1 to glycogen have been identified. This gene encodes a glycogen-targeting subunit of PP1. [provided by RefSeq, Jul 2008]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 2bp deletion in a coding exon of PPP1R3D. |
| Description | 2bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | CAGGCGCTCGCCAAAGTCGG |
| PCR Primer |
Forward: TACTGGAAAGCCGAAGGTGAAAA Reverse: CACAGGTCAAGGTGTTCAACG |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.