Online Inquiry
PPP1R3B Knockout Cell Line
SPL-02735
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 5bp deletion |
| Target Information | |
|---|---|
| Target Name | PPP1R3B |
| Gene Abbr. | PPP1R3B |
| Gene ID | 79660 |
| Full Name | protein phosphatase 1 regulatory subunit 3B |
| Alias | GL, PPP1R4, PTG |
| Species | Human |
| Genomic Locus | chr8:9141493 |
| Transcript | NM_024607 |
| WT Expression Level | 2.09 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes the catalytic subunit of the serine/theonine phosphatase, protein phosphatase-1. The encoded protein is expressed in liver and skeletal muscle tissue and may be involved in regulating glycogen synthesis in these tissues. This gene may be a involved in type 2 diabetes and maturity-onset diabetes of the young. Alternate splicing results in multiple transcript variants that encode the same protein.[provided by RefSeq, Jan 2011]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 5bp deletion in a coding exon of PPP1R3B. |
| Description | 5bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | AGCCGGGGCCACCATTCCAC |
| PCR Primer |
Forward: GGGAAAAATCCAGAACAAAGCTCTC Reverse: GTGGACATCGAGTACAGATACAACT |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.