Online Inquiry
PPP1R16A Knockout Cell Line
SPL-02720
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 13bp deletion |
| Target Information | |
|---|---|
| Target Name | PPP1R16A |
| Gene Abbr. | PPP1R16A |
| Gene ID | 84988 |
| Full Name | protein phosphatase 1 regulatory subunit 16A |
| Alias | MYPT3 |
| Species | Human |
| Genomic Locus | chr8:144498799 |
| Transcript | NM_032902 |
| WT Expression Level | 11.33 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | Myosin light chain kinase and phosphatase (MLCP) complexes control the phosphorylation states of regulatory myosin light chains, which is crucial for muscle and intracellular movement. MLCPs typically contain a catalytic protein phosphatase 1 (PP1c) subunit, a myosin phosphatase targeting (MYPT) subunit, and another smaller subunit. The protein encoded by this gene represents an MYPT subunit, which is responsible for directing PP1c to its intended targets. However, while other MYPTs result in PP1c activation after becoming phosphorylated, the encoded protein is phosphorylated by protein kinase A and then inhibits the catalytic activity of PP1c. [provided by RefSeq, Jul 2016]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 13bp deletion in a coding exon of PPP1R16A. |
| Description | 13bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | CCTGACTTGGCCAACGAGGA |
| PCR Primer |
Forward: CACCACTGTCTTCCTTGTCCTT Reverse: ACCATCTCTCGGAAATCATCAATGC |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.