Online Inquiry
PPP1R14C Knockout Cell Line
SPL-02719
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 11bp deletion |
| Target Information | |
|---|---|
| Target Name | PPP1R14C |
| Gene Abbr. | PPP1R14C |
| Gene ID | 81706 |
| Full Name | protein phosphatase 1 regulatory inhibitor subunit 14C |
| Alias | CPI17-like, KEPI, NY-BR-81 |
| Species | Human |
| Genomic Locus | chr6:150143416 |
| Transcript | NM_030949 |
| WT Expression Level | 5.30 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | The degree of protein phosphorylation is regulated by a balance of protein kinase and phosphatase activities. Protein phosphatase-1 (PP1; see MIM 176875) is a signal-transducing phosphatase that influences neuronal activity, protein synthesis, metabolism, muscle contraction, and cell division. PPP1R14C is an inhibitor of PP1 (Liu et al., 2002 [PubMed 11812771]).[supplied by OMIM, Feb 2010]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 11bp deletion in a coding exon of PPP1R14C. |
| Description | 11bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | AATACGATCGTAAGGAGCTT |
| PCR Primer |
Forward: CACGGGTTTTCTTCCAAAGCC Reverse: CTGGAGCCCGGGAAAATTACT |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.