Online Inquiry
PPP1R13B Knockout Cell Line
SPL-02716
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 5bp deletion |
| Target Information | |
|---|---|
| Target Name | PPP1R13B |
| Gene Abbr. | PPP1R13B |
| Gene ID | 23368 |
| Full Name | protein phosphatase 1 regulatory subunit 13B |
| Alias | ASPP1, p53BP2-like, p85 |
| Species | Human |
| Genomic Locus | chr14:103784825 |
| Transcript | NM_015316 |
| WT Expression Level | 8.65 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes a member of the ASPP (apoptosis-stimulating protein of p53) family of p53 interacting proteins. The protein contains four ankyrin repeats and an SH3 domain involved in protein-protein interactions. ASPP proteins are required for the induction of apoptosis by p53-family proteins. They promote DNA binding and transactivation of p53-family proteins on the promoters of proapoptotic genes. Expression of this gene is regulated by the E2F transcription factor. [provided by RefSeq, Jul 2008]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 5bp deletion in a coding exon of PPP1R13B. |
| Description | 5bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | GAAATTTTTCCTTCGACACG |
| PCR Primer |
Forward: GCCGTAATGGTAAACAACACTAACA Reverse: TGGTTGGAGTCATTTTAATTCTGGA |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.