PPP1R12A cDNA ORF Clone, Human, untagged - CD BioSciences

service-banner

PPP1R12A cDNA ORF Clone, Human, untagged

PPP1R12A cDNA ORF Clone, Human, untagged

SPD-10587

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human protein phosphatase 1, regulatory subunit 12A.
Target Information
Species Human
Target Name MYPT1
Gene Abbr. PPP1R12A
Gene ID 4659
Full Name protein phosphatase 1 regulatory subunit 12A
Alias GUBS, M130, MBS, MYPT1
Introduction Protein phosphatase 1 (PP1) is a ubiquitous eukaryotic protein serine/threonine phosphatase involved in the regulation of various cell functions. Substrate specificity is determined by the binding of a regulatory subunit to the PP1 catalytic subunit (PP1c). It is estimated that over fifty different regulatory subunits exist.The myosin phosphatase holoenzyme is composed of three subunits: PP1c, a targeting/regulatory subunit (MYPT/myosin-binding subunit of myosin phosphatase), and a 20 kDa subunit of unknown function (M20). MYPT binding to PP1cδ alters the conformation of the catalytic cleft and increases enzyme activity and specificity. Two MYPT isoforms that are 61% identical have been described. MYPT1 is widely expressed, while MYPT2 expression appears to be exclusive to heart and brain. Related family members include MBS85, MYPT3, and TIMAP.Myosin phosphatase regulates the interaction of actin and myosin in response to signaling through the small GTPase Rho. Rho activity inhibits myosin phosphatase via Rho-associated kinase (ROCK). Phosphorylation of MYPT1 at Thr696 and Thr853 results in phosphatase inhibition and cytoskeletal reorganization.
Product Details
Description Full length Clone DNA of Human protein phosphatase 1, regulatory subunit 12A.
NCBI Ref Seq BC111752
RefSeq ORF Size 3093 bp
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.