Online Inquiry
PPP1R12A cDNA ORF Clone, Human, N-FLAG tag
SPD-10583
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Human protein phosphatase 1, regulatory subunit 12A with N terminal Flag tag. |
| Target Information | |
|---|---|
| Species | Human |
| Target Name | MYPT1 |
| Gene Abbr. | PPP1R12A |
| Gene ID | 4659 |
| Full Name | protein phosphatase 1 regulatory subunit 12A |
| Alias | GUBS, M130, MBS, MYPT1 |
| Introduction | Protein phosphatase 1 (PP1) is a ubiquitous eukaryotic protein serine/threonine phosphatase involved in the regulation of various cell functions. Substrate specificity is determined by the binding of a regulatory subunit to the PP1 catalytic subunit (PP1c). It is estimated that over fifty different regulatory subunits exist.The myosin phosphatase holoenzyme is composed of three subunits: PP1c, a targeting/regulatory subunit (MYPT/myosin-binding subunit of myosin phosphatase), and a 20 kDa subunit of unknown function (M20). MYPT binding to PP1cδ alters the conformation of the catalytic cleft and increases enzyme activity and specificity. Two MYPT isoforms that are 61% identical have been described. MYPT1 is widely expressed, while MYPT2 expression appears to be exclusive to heart and brain. Related family members include MBS85, MYPT3, and TIMAP.Myosin phosphatase regulates the interaction of actin and myosin in response to signaling through the small GTPase Rho. Rho activity inhibits myosin phosphatase via Rho-associated kinase (ROCK). Phosphorylation of MYPT1 at Thr696 and Thr853 results in phosphatase inhibition and cytoskeletal reorganization. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Human protein phosphatase 1, regulatory subunit 12A with N terminal Flag tag. |
| NCBI Ref Seq | BC111752 |
| RefSeq ORF Size | 3132 bp |
| Sequence Information | Identical with the Gene Bank Ref. ID sequence. |
| Vector | pCMV3-N-FLAG |
| Promoter | Enhanced CMV promoter |
| Tag Sequence | FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG |
| Restriction Sites | KpnI + NotI (6kb + 3.13kb) |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Kanamycin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.