Online Inquiry
PPP1CA Knockout Cell Line
SPL-02714
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 58bp insertion |
| Target Information | |
|---|---|
| Target Name | PP1α |
| Gene Abbr. | PPP1CA |
| Gene ID | 5499 |
| Full Name | protein phosphatase 1 catalytic subunit alpha |
| Alias | PP-1A, PP1A, PP1alpha, PPP1A |
| Species | Human |
| Genomic Locus | chr11:67400872 |
| Transcript | NM_002708 |
| WT Expression Level | 202.73 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | The protein encoded by this gene is one of the three catalytic subunits of protein phosphatase 1 (PP1). PP1 is a serine/threonine specific protein phosphatase known to be involved in the regulation of a variety of cellular processes, such as cell division, glycogen metabolism, muscle contractility, protein synthesis, and HIV-1 viral transcription. Increased PP1 activity has been observed in the end stage of heart failure. Studies in both human and mice suggest that PP1 is an important regulator of cardiac function. Mouse studies also suggest that PP1 functions as a suppressor of learning and memory. Three alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 58bp insertion in a coding exon of PPP1CA. |
| Description | 58bp insertion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | CATACTCAAATAGTCGCAGA |
| PCR Primer |
Forward: GTAGAAACCATAGATGCGGTTGATG Reverse: CCTTCCTAAAAGTGGCACTGGA |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.