Online Inquiry
PPM1K Knockout Cell Line
SPL-02707
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 2bp deletion |
| Target Information | |
|---|---|
| Target Name | PPM1K |
| Gene Abbr. | PPM1K |
| Gene ID | 152926 |
| Full Name | protein phosphatase, Mg2+/Mn2+ dependent 1K |
| Alias | BDP, MSUDMV, PP2Ckappa, PP2Cm, PTMP |
| Species | Human |
| Genomic Locus | chr4:88278429 |
| Transcript | NM_152542 |
| WT Expression Level | 10.24 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes a member of the PPM family of Mn2+/Mg2+-dependent protein phosphatases. The encoded protein, essential for cell survival and development, is targeted to the mitochondria where it plays a key role in regulation of the mitochondrial permeability transition pore. [provided by RefSeq, Sep 2012]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 2bp deletion in a coding exon of PPM1K. |
| Description | 2bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | GGGTCAAACCGAGAACACCT |
| PCR Primer |
Forward: CATCATACACTGCAAAGTACAGGAC Reverse: AACAGCTGCCTTAATTACTTTGGTC |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.