PPM1K Knockout Cell Line - CD BioSciences

service-banner

PPM1K Knockout Cell Line

PPM1K Knockout Cell Line

SPL-02706

Size Price
1 Unit Online Inquiry
Description
17bp deletion
Target Information
Target Name PPM1K
Gene Abbr. PPM1K
Gene ID 152926
Full Name protein phosphatase, Mg2+/Mn2+ dependent 1K
Alias BDP, MSUDMV, PP2Ckappa, PP2Cm, PTMP
Species Human
Genomic Locus chr4:88278429
Transcript NM_152542
WT Expression Level 10.24 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction This gene encodes a member of the PPM family of Mn2+/Mg2+-dependent protein phosphatases. The encoded protein, essential for cell survival and development, is targeted to the mitochondria where it plays a key role in regulation of the mitochondrial permeability transition pore. [provided by RefSeq, Sep 2012].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 17bp deletion in a coding exon of PPM1K.
Description 17bp deletion
Parental Cell Line C631
Guide RNA Sequence GGGTCAAACCGAGAACACCT
PCR Primer Forward: CATCATACACTGCAAAGTACAGGAC
Reverse: AACAGCTGCCTTAATTACTTTGGTC
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.