Online Inquiry
PPM1F Knockout Cell Line
SPL-02701
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 4bp deletion |
| Target Information | |
|---|---|
| Target Name | PPM1F |
| Gene Abbr. | PPM1F |
| Gene ID | 9647 |
| Full Name | protein phosphatase, Mg2+/Mn2+ dependent 1F |
| Alias | CAMKP, CaMKPase, FEM-2, POPX2, hFEM-2 |
| Species | Human |
| Genomic Locus | chr22:21939602 |
| Transcript | NM_014634 |
| WT Expression Level | 14.51 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | The protein encoded by this gene is a member of the PP2C family of Ser/Thr protein phosphatases. PP2C family members are known to be negative regulators of cell stress response pathways. This phosphatase can interact with Rho guanine nucleotide exchange factors (PIX), and thus block the effects of p21-activated kinase 1 (PAK), a protein kinase mediating biological effects downstream of Rho GTPases. Calcium/calmodulin-dependent protein kinase II gamma (CAMK2G/CAMK-II) is found to be one of the substrates of this phosphatase. The overexpression of this phosphatase or CAMK2G has been shown to mediate caspase-dependent apoptosis. An alternatively spliced transcript variant has been identified, but its full-length nature has not been determined. [provided by RefSeq, Jul 2008]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 4bp deletion in a coding exon of PPM1F. |
| Description | 4bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | AGACAGACCTTTCCGAATTC |
| PCR Primer |
Forward: CTGGGAACTATATGACCTGTGGAG Reverse: GTTTACTTGCCCATCAACAGCC |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.