Online Inquiry
PPM1A Knockout Cell Line
SPL-02697
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 5bp deletion |
| Target Information | |
|---|---|
| Target Name | PPM1A |
| Gene Abbr. | PPM1A |
| Gene ID | 5494 |
| Full Name | protein phosphatase, Mg2+/Mn2+ dependent 1A |
| Alias | PP2C-ALPHA, PP2CA, PP2Calpha |
| Species | Human |
| Genomic Locus | chr14:60282840 |
| Transcript | NM_021003 |
| WT Expression Level | 26.00 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | The protein encoded by this gene is a member of the PP2C family of Ser/Thr protein phosphatases. PP2C family members are known to be negative regulators of cell stress response pathways. This phosphatase dephosphorylates, and negatively regulates the activities of, MAP kinases and MAP kinase kinases. It has been shown to inhibit the activation of p38 and JNK kinase cascades induced by environmental stresses. This phosphatase can also dephosphorylate cyclin-dependent kinases, and thus may be involved in cell cycle control. Overexpression of this phosphatase is reported to activate the expression of the tumor suppressor gene TP53/p53, which leads to G2/M cell cycle arrest and apoptosis. Three alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2008]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 5bp deletion in a coding exon of PPM1A. |
| Description | 5bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | TGCCAAGTGGACTTGAATCG |
| PCR Primer |
Forward: GGAGCATTTTTAGACAAGCCAAAGA Reverse: ACTCTCATGTGTTCATCAATCTCCA |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.