Online Inquiry
PPEF1 Knockout Cell Line
SPL-02692
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 1bp insertion |
| Target Information | |
|---|---|
| Target Name | PPEF1 |
| Gene Abbr. | PPEF1 |
| Gene ID | 5475 |
| Full Name | protein phosphatase with EF-hand domain 1 |
| Alias | PP7, PPEF, PPP7C, PPP7CA |
| Species | Human |
| Genomic Locus | chrX:18730244 |
| Transcript | NM_006240 |
| WT Expression Level | 1.60 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes a member of the serine/threonine protein phosphatase with EF-hand motif family. The protein contains a protein phosphatase catalytic domain, and at least two EF-hand calcium-binding motifs in its C terminus. Although its substrate(s) is unknown, the encoded protein has been suggested to play a role in specific sensory neuron function and/or development. This gene shares high sequence similarity with the Drosophila retinal degeneration C (rdgC) gene. Several alternatively spliced transcript variants, each encoding a distinct isoform, have been described. [provided by RefSeq, Jul 2008]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 1bp insertion in a coding exon of PPEF1. |
| Description | 1bp insertion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | GGTGAGGGCATAGTGTTGTC |
| PCR Primer |
Forward: CTGAAGCACCTACTTCTCCTAACAG Reverse: CTCAGCTTAAAATGGACCCAAACTT |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.