Online Inquiry
PPARGC1A cDNA ORF Clone, Human, untagged
SPD-11361
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Human peroxisome proliferator-activated receptor gamma, coactivator 1 alpha. |
| Target Information | |
|---|---|
| Species | Human |
| Target Name | PGC-1α |
| Gene Abbr. | PPARGC1A |
| Gene ID | 10891 |
| Full Name | PPARG coactivator 1 alpha |
| Alias | LEM6, PGC-1(alpha), PGC-1alpha, PGC-1v, PGC1 |
| Introduction | PPARγ coactivator-1α (PGC-1α) was originally identified as a transcriptional coactivator whose expression closely correlated with adaptive thermogenesis following exposure to cold temperatures. Named for its association with the nuclear receptor peroxisome-proliferator activated receptor (PPARγ), PGC-1α interacts with a diverse array of transcription factors to regulate numerous aspects of cell physiology. PGC-1α helps to regulate cell processes important in adaptive thermogenesis and energy metabolism, including the related functions of glucose uptake, gluconeogenesis, insulin secretion, and mitochondrial biogenesis. Long thought to be a potential therapeutic target for the treatment of type II diabetes, obesity, cardiomyopathy, or other metabolic disorders, a recent functional survey found no obvious differences in PPARγ activity associated with recognized PGC-1α variants. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Human peroxisome proliferator-activated receptor gamma, coactivator 1 alpha. |
| NCBI Ref Seq | NM_013261.3 |
| RefSeq ORF Size | 2397 bp |
| Sequence Information | Identical with the Gene Bank Ref. ID sequence except for the point mutations: 1182 A>G and 1584 G>A not causing the amino acid variation. |
| Vector | pCMV3-untagged |
| Promoter | Enhanced CMV promoter |
| Restriction Sites | KpnI + NotI (6.1kb + 2.4kb) |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Ampicillin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.