PPARGC1A cDNA ORF Clone, Human, C-Myc tag - CD BioSciences

service-banner

PPARGC1A cDNA ORF Clone, Human, C-Myc tag

PPARGC1A cDNA ORF Clone, Human, C-Myc tag

SPD-11354

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human peroxisome proliferator-activated receptor gamma, coactivator 1 alpha with C terminal Myc tag.
Target Information
Species Human
Target Name PGC-1α
Gene Abbr. PPARGC1A
Gene ID 10891
Full Name PPARG coactivator 1 alpha
Alias LEM6, PGC-1(alpha), PGC-1alpha, PGC-1v, PGC1
Introduction PPARγ coactivator-1α (PGC-1α) was originally identified as a transcriptional coactivator whose expression closely correlated with adaptive thermogenesis following exposure to cold temperatures. Named for its association with the nuclear receptor peroxisome-proliferator activated receptor (PPARγ), PGC-1α interacts with a diverse array of transcription factors to regulate numerous aspects of cell physiology. PGC-1α helps to regulate cell processes important in adaptive thermogenesis and energy metabolism, including the related functions of glucose uptake, gluconeogenesis, insulin secretion, and mitochondrial biogenesis. Long thought to be a potential therapeutic target for the treatment of type II diabetes, obesity, cardiomyopathy, or other metabolic disorders, a recent functional survey found no obvious differences in PPARγ activity associated with recognized PGC-1α variants.
Product Details
Description Full length Clone DNA of Human peroxisome proliferator-activated receptor gamma, coactivator 1 alpha with C terminal Myc tag.
NCBI Ref Seq NM_013261.3
RefSeq ORF Size 2442 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence except for the point mutations: 1182A/G,1584G/A not causing the amino acid variation.
Vector pCMV3-C-Myc
Promoter Enhanced CMV promoter
Tag Sequence Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Restriction Sites KpnI + NotI (6kb + 2.44kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.