Pparg cDNA ORF Clone, Mouse, untagged - CD BioSciences

service-banner

Pparg cDNA ORF Clone, Mouse, untagged

Pparg cDNA ORF Clone, Mouse, untagged

SPD-11816

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse peroxisome proliferator activated receptor gamma.
Target Information
Species Mouse
Target Name PPAR
Gene Abbr. Pparg
Gene ID 19016
Full Name peroxisome proliferator activated receptor gamma
Alias Nr1, Nr1c3, PPA, PPAR, PPAR-gamma
Introduction Peroxisome proliferator-activated receptor γ (PPARγ) is a member of the ligand-activated nuclear receptor superfamily and functions as a transcriptional activator. PPARγ is preferentially expressed in adipocytes as well as in vascular smooth muscle cells and macrophage. Besides its role in mediating adipogenesis and lipid metabolism PPARγ also modulates insulin sensitivity, cell proliferation and inflammation. PPARγ transcriptional activity is inhibited by MAP kinase phosphorylation of PPARγ at Ser84.
Product Details
Description Full length Clone DNA of Mouse peroxisome proliferator activated receptor gamma.
NCBI Ref Seq NM_001127330.1
RefSeq ORF Size 1428 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Restriction Sites KpnI + XbaI (6.1kb + 1.43kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.