Online Inquiry
PPARG cDNA ORF Clone, Human, C-FLAG tag
SPD-11817
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Human peroxisome proliferator-activated receptor gamma with C terminal Flag tag. |
Target Information | |
---|---|
Species | Human |
Target Name | PPAR |
Gene Abbr. | PPARG |
Gene ID | 5468 |
Full Name | peroxisome proliferator activated receptor gamma |
Alias | CIMT1, GLM1, NR1C3, PPARG1, PPARG2 |
Introduction | Peroxisome proliferator-activated receptor γ (PPARγ) is a member of the ligand-activated nuclear receptor superfamily and functions as a transcriptional activator. PPARγ is preferentially expressed in adipocytes as well as in vascular smooth muscle cells and macrophage. Besides its role in mediating adipogenesis and lipid metabolism PPARγ also modulates insulin sensitivity, cell proliferation and inflammation. PPARγ transcriptional activity is inhibited by MAP kinase phosphorylation of PPARγ at Ser84. |
Product Details | |
---|---|
Description | Full length Clone DNA of Human peroxisome proliferator-activated receptor gamma with C terminal Flag tag. |
NCBI Ref Seq | NM_015869.4 |
RefSeq ORF Size | 1518 bp |
Sequence Information | Identical with the Gene Bank Ref. ID sequence. |
Vector | pCMV3-C-FLAG |
Promoter | Enhanced CMV promoter |
Tag Sequence | FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG |
Restriction Sites | KpnI + XbaI (6kb + 1.57kb) |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.