Online Inquiry
POMGNT1 Knockout Cell Line
SPL-02689
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 8bp deletion |
| Target Information | |
|---|---|
| Target Name | POMGNT1 |
| Gene Abbr. | POMGNT1 |
| Gene ID | 55624 |
| Full Name | protein O-linked mannose N-acetylglucosaminyltransferase 1 (beta 1,2-) |
| Alias | GNTI.2, GnT I.2, LGMD2O, LGMDR15, MEB |
| Species | Human |
| Genomic Locus | chr1:46197750 |
| Transcript | NM_017739 |
| WT Expression Level | 58.77 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes a type II transmembrane protein that resides in the Golgi apparatus. It participates in O-mannosyl glycosylation and is specific for alpha linked terminal mannose. Mutations in this gene may be associated with muscle-eye-brain disease and several congenital muscular dystrophies. Alternatively spliced transcript variants that encode different protein isoforms have been described. [provided by RefSeq, Feb 2014]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 8bp deletion in a coding exon of POMGNT1. |
| Description | 8bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | AGCGGAGCTGGTACCTTACC |
| PCR Primer |
Forward: TATAGGGACATGACACATAGAGGTC Reverse: ATCAGACTTTGGGAGGAGCATCTTA |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.