POMGNT1 Knockout Cell Line - CD BioSciences

service-banner

POMGNT1 Knockout Cell Line

POMGNT1 Knockout Cell Line

SPL-02688

Size Price
1 Unit Online Inquiry
Description
5bp deletion
Target Information
Target Name POMGNT1
Gene Abbr. POMGNT1
Gene ID 55624
Full Name protein O-linked mannose N-acetylglucosaminyltransferase 1 (beta 1,2-)
Alias GNTI.2, GnT I.2, LGMD2O, LGMDR15, MEB
Species Human
Genomic Locus chr1:46197750
Transcript NM_017739
WT Expression Level 58.77 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction This gene encodes a type II transmembrane protein that resides in the Golgi apparatus. It participates in O-mannosyl glycosylation and is specific for alpha linked terminal mannose. Mutations in this gene may be associated with muscle-eye-brain disease and several congenital muscular dystrophies. Alternatively spliced transcript variants that encode different protein isoforms have been described. [provided by RefSeq, Feb 2014].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 5bp deletion in a coding exon of POMGNT1.
Description 5bp deletion
Parental Cell Line C631
Guide RNA Sequence AGCGGAGCTGGTACCTTACC
PCR Primer Forward: TATAGGGACATGACACATAGAGGTC
Reverse: ATCAGACTTTGGGAGGAGCATCTTA
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.