POLN Knockout Cell Line - CD BioSciences

service-banner

POLN Knockout Cell Line

POLN Knockout Cell Line

SPL-02686

Size Price
1 Unit Online Inquiry
Description
31bp deletion
Target Information
Target Name POLN
Gene Abbr. POLN
Gene ID 353497
Full Name DNA polymerase nu
Alias POL4P
Species Human
Genomic Locus chr4:2208156
Transcript NM_181808
WT Expression Level 0.83 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction This gene encodes a DNA polymerase type-A family member. The encoded protein plays a role in DNA repair and homologous recombination. This gene shares its 5' exons with some transcripts from overlapping GeneID: 79441, which encodes an augmentin-like protein complex subunit. [provided by RefSeq, Dec 2014].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 31bp deletion in a coding exon of POLN.
Description 31bp deletion
Parental Cell Line C631
Guide RNA Sequence GAAGATACTGATGACGCCGA
PCR Primer Forward: AATGGGCTTCTTTTATGGTGTCAAG
Reverse: TCAGTTCTACAGAAAAAGGGGCATA
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.