Online Inquiry
POLN Knockout Cell Line
SPL-02685
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 160bp insertion |
| Target Information | |
|---|---|
| Target Name | POLN |
| Gene Abbr. | POLN |
| Gene ID | 353497 |
| Full Name | DNA polymerase nu |
| Alias | POL4P |
| Species | Human |
| Genomic Locus | chr4:2208156 |
| Transcript | NM_181808 |
| WT Expression Level | 0.83 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes a DNA polymerase type-A family member. The encoded protein plays a role in DNA repair and homologous recombination. This gene shares its 5' exons with some transcripts from overlapping GeneID: 79441, which encodes an augmentin-like protein complex subunit. [provided by RefSeq, Dec 2014]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 160bp insertion in a coding exon of POLN. |
| Description | 160bp insertion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | GAAGATACTGATGACGCCGA |
| PCR Primer |
Forward: AATGGGCTTCTTTTATGGTGTCAAG Reverse: TCAGTTCTACAGAAAAAGGGGCATA |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.