Online Inquiry
POLL Knockout Cell Line
SPL-02680
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 5bp deletion |
| Target Information | |
|---|---|
| Target Name | POLL |
| Gene Abbr. | POLL |
| Gene ID | 27343 |
| Full Name | DNA polymerase lambda |
| Alias | BETAN, POLKAPPA |
| Species | Human |
| Genomic Locus | chr10:101587308 |
| Transcript | NM_013274 |
| WT Expression Level | 18.49 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes a DNA polymerase. DNA polymerases catalyze DNA-template-directed extension of the 3'-end of a DNA strand. This particular polymerase, which is a member of the X family of DNA polymerases, likely plays a role in non-homologous end joining and other DNA repair processes. Alternatively spliced transcript variants have been described. [provided by RefSeq, Mar 2010]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 5bp deletion in a coding exon of POLL. |
| Description | 5bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | GCATGAATTTTCTGCCGCTT |
| PCR Primer |
Forward: GAAGTTTAACCGGGTTTGAAGAGAC Reverse: GATTCTGGACATAAACAACGTAGGG |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.