Online Inquiry
POLK Knockout Cell Line
SPL-02678
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
5bp deletion |
Target Information | |
---|---|
Target Name | POLK |
Gene Abbr. | POLK |
Gene ID | 51426 |
Full Name | DNA polymerase kappa |
Alias | DINB1, DINP, POLQ |
Species | Human |
Genomic Locus | chr5:75552522 |
Transcript | NM_016218 |
WT Expression Level | 8.11 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
Introduction | This gene encodes a member of the DNA polymerase type-Y family of proteins. The encoded protein is a specialized DNA polymerase that catalyzes translesion DNA synthesis, which allows DNA replication in the presence of DNA lesions. Human cell lines lacking a functional copy of this gene exhibit impaired genome integrity and enhanced susceptibility to oxidative damage. Mutations in this gene that impair enzyme activity may be associated with prostate cancer in human patients. [provided by RefSeq, Sep 2016]. |
Product Details | |
---|---|
Cell Line Model | HAP1 |
Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 5bp deletion in a coding exon of POLK. |
Description | 5bp deletion |
Parental Cell Line | C631 |
Guide RNA Sequence | GCATCATATTTTCAATTCGT |
PCR Primer |
Forward: GCAGAGCAACACTTAGCAAAGTAAA Reverse: TTAGCCACCAGGTTATACTACAGTG |
Handling Specifications | |
---|---|
Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
Culture Medium | IMDM + 10% FCS |
Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
Freeze Medium | IMDM + 20% FCS + 10% DMSO |
Biosafety Level | BSL-1 |
Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.