POLH Knockout Cell Line - CD BioSciences

service-banner

POLH Knockout Cell Line

POLH Knockout Cell Line

SPL-02672

Size Price
1 Unit Online Inquiry
Description
1bp deletion
Target Information
Target Name POLH
Gene Abbr. POLH
Gene ID 5429
Full Name DNA polymerase eta
Alias RAD30, RAD30A, XP-V, XPV
Species Human
Genomic Locus chr6:43583102
Transcript NM_006502
WT Expression Level 18.91 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction This gene encodes a member of the Y family of specialized DNA polymerases. It copies undamaged DNA with a lower fidelity than other DNA-directed polymerases. However, it accurately replicates UV-damaged DNA; when thymine dimers are present, this polymerase inserts the complementary nucleotides in the newly synthesized DNA, thereby bypassing the lesion and suppressing the mutagenic effect of UV-induced DNA damage. This polymerase is thought to be involved in hypermutation during immunoglobulin class switch recombination. Mutations in this gene result in XPV, a variant type of xeroderma pigmentosum. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2014].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 1bp deletion in a coding exon of POLH.
Description 1bp deletion
Parental Cell Line C631
Guide RNA Sequence CACAAGTTCGTGAGTCCCGT
PCR Primer Forward: GGCATCTGTGGTCAAAAAGTTTCTA
Reverse: TCATTTCACAGAGACAAGATGGCTA
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.