Online Inquiry
POLE4 Knockout Cell Line
SPL-02671
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 35bp deletion |
| Target Information | |
|---|---|
| Target Name | POLE4 |
| Gene Abbr. | POLE4 |
| Gene ID | 56655 |
| Full Name | DNA polymerase epsilon 4, accessory subunit |
| Alias | YHHQ1, p12 |
| Species | Human |
| Genomic Locus | chr2:74959370 |
| Transcript | NM_019896 |
| WT Expression Level | 21.65 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | POLE4 is a histone-fold protein that interacts with other histone-fold proteins to bind DNA in a sequence-independent manner. These histone-fold protein dimers combine within larger enzymatic complexes for DNA transcription, replication, and packaging.[supplied by OMIM, Apr 2004]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 35bp deletion in a coding exon of POLE4. |
| Description | 35bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | TGCCTACTGTTGCGCTCAGC |
| PCR Primer |
Forward: GGAGTCTTTAGTGAATGAGGGAGAA Reverse: ATCAGAGTGACGTCTTCTCAACCTG |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.