Online Inquiry
POGZ Knockout Cell Line
SPL-02667
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 1bp insertion |
| Target Information | |
|---|---|
| Target Name | POGZ |
| Gene Abbr. | POGZ |
| Gene ID | 23126 |
| Full Name | pogo transposable element derived with ZNF domain |
| Alias | MRD37, WHSUS, ZNF280E, ZNF635, ZNF635m |
| Species | Human |
| Genomic Locus | chr1:151424986 |
| Transcript | NM_207171 |
| WT Expression Level | 37.54 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | The protein encoded by this gene appears to be a zinc finger protein containing a transposase domain at the C-terminus. This protein was found to interact with the transcription factor SP1 in a yeast two-hybrid system. Alternatively spliced transcript variants encoding distinct isoforms have been observed. [provided by RefSeq, Aug 2010]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 1bp insertion in a coding exon of POGZ. |
| Description | 1bp insertion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | CGAAATTGAGCATTACATCG |
| PCR Primer |
Forward: AAAAGCTTCAGTCATTTTAGAGCCC Reverse: TACTTCTCAGGGAGTGTTTGACTTT |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.