Pnpla2 cDNA ORF Clone, Mouse, N-FLAG tag - CD BioSciences

service-banner

Pnpla2 cDNA ORF Clone, Mouse, N-FLAG tag

Pnpla2 cDNA ORF Clone, Mouse, N-FLAG tag

SPD-01348

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse patatin-like phospholipase domain containing 2 with N terminal Flag tag.
Target Information
Species Mouse
Target Name ATGL
Gene Abbr. Pnpla2
Gene ID 66853
Full Name patatin-like phospholipase domain containing 2
Alias 0610039C21Rik, 1110001C14Rik, At, Atgl, TTS-2.2
Introduction ATGL (adipose triglyceride lipase) is the rate-limiting lipolytic enzyme which catalyzes initial step of triglyceride (TAG) hydrolysis in adipocytes as well as non-adipocyte lipid droplets. Among adipose lipases (ATGL, hormone-sensitive lipase/HSL and monoacylglycerol lipase), HSL is a diacylglycerol lipase, whereas ATGL prefers TAG substrates. CGI-58 coactivates ATGL's reactions and G0/G1 switch gene 2 exerts supressive effects on ATGL. Localized in lipid droplet and cell membrane as single-pass type II membrane protein, ATGL is mainly expressed in adipose tissue, however, has also been reported in cardiac/skeletal muscles, gastrointestinal tract, normal retina and retinoblastoma. ATGL is inhibited by BEL and is activated by ABHD5 as well as SERPINF1, and is induced during differentiation of primary preadipocytes to adipocytes with expression increasing from fetal to adult in RPE cells. Besides TAG hydrolysis, ATGL has acylglycerol transacylase activity also and can act coordinately with LIPE/HLS within the lipolytic cascade, regulate size of adiposome and implicate in adiposomes degradation. ATGL implicates in energy homeostasis/response to starvation by enhancing TAGs hydrolysis and providing free fatty acids to be oxidized in situations of energy depletion. ATGL genetic variations have been linked with risk of NIDDM and neutral lipid storage disease with myopathy (NLSDM).
Product Details
Description Full length Clone DNA of Mouse patatin-like phospholipase domain containing 2 with N terminal Flag tag.
NCBI Ref Seq NM_001163689.1
RefSeq ORF Size 1461 bp
Vector pCMV3-N-FLAG
Promoter Enhanced CMV promoter
Tag Sequence FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.