Online Inquiry
Pnpla2 cDNA ORF Clone, Mouse, C-His tag
SPD-01344
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Mouse patatin-like phospholipase domain containing 2 with C terminal His tag. |
| Target Information | |
|---|---|
| Species | Mouse |
| Target Name | ATGL |
| Gene Abbr. | Pnpla2 |
| Gene ID | 66853 |
| Full Name | patatin-like phospholipase domain containing 2 |
| Alias | 0610039C21Rik, 1110001C14Rik, At, Atgl, TTS-2.2 |
| Introduction | ATGL (adipose triglyceride lipase) is the rate-limiting lipolytic enzyme which catalyzes initial step of triglyceride (TAG) hydrolysis in adipocytes as well as non-adipocyte lipid droplets. Among adipose lipases (ATGL, hormone-sensitive lipase/HSL and monoacylglycerol lipase), HSL is a diacylglycerol lipase, whereas ATGL prefers TAG substrates. CGI-58 coactivates ATGL's reactions and G0/G1 switch gene 2 exerts supressive effects on ATGL. Localized in lipid droplet and cell membrane as single-pass type II membrane protein, ATGL is mainly expressed in adipose tissue, however, has also been reported in cardiac/skeletal muscles, gastrointestinal tract, normal retina and retinoblastoma. ATGL is inhibited by BEL and is activated by ABHD5 as well as SERPINF1, and is induced during differentiation of primary preadipocytes to adipocytes with expression increasing from fetal to adult in RPE cells. Besides TAG hydrolysis, ATGL has acylglycerol transacylase activity also and can act coordinately with LIPE/HLS within the lipolytic cascade, regulate size of adiposome and implicate in adiposomes degradation. ATGL implicates in energy homeostasis/response to starvation by enhancing TAGs hydrolysis and providing free fatty acids to be oxidized in situations of energy depletion. ATGL genetic variations have been linked with risk of NIDDM and neutral lipid storage disease with myopathy (NLSDM). |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Mouse patatin-like phospholipase domain containing 2 with C terminal His tag. |
| NCBI Ref Seq | NM_001163689.1 |
| RefSeq ORF Size | 1461 bp |
| Vector | pCMV3-C-His |
| Promoter | Enhanced CMV promoter |
| Tag Sequence | His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Kanamycin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.