PNCK Knockout Cell Line - CD BioSciences

service-banner

PNCK Knockout Cell Line

PNCK Knockout Cell Line

SPL-02661

Size Price
1 Unit Online Inquiry
Description
14bp deletion
Target Information
Target Name PNCK
Gene Abbr. PNCK
Gene ID 139728
Full Name pregnancy up-regulated nonubiquitous CaM kinase
Alias BSTK3, CaMK1b
Species Human
Genomic Locus chrX:153673015
Transcript NM_001135740
WT Expression Level 17.67 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction PNCK is a member of the calcium/calmodulin-dependent protein kinase family of protein serine/threonine kinases (see CAMK1; MIM 604998) (Gardner et al., 2000 [PubMed 10673339]).[supplied by OMIM, Mar 2008].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 14bp deletion in a coding exon of PNCK.
Description 14bp deletion
Parental Cell Line C631
Guide RNA Sequence TACGAGATCCGCGAGAGGCT
PCR Primer Forward: GATGTGGAGGCGTGTATGCG
Reverse: ACACACCCCTACATATTCACACA
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.