PNCK cDNA ORF Clone, Human, untagged - CD BioSciences

service-banner

PNCK cDNA ORF Clone, Human, untagged

PNCK cDNA ORF Clone, Human, untagged

SPD-11703

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human pregnancy up-regulated non-ubiquitously expressed CaM kinase.
Target Information
Species Human
Target Name PNCK
Gene Abbr. PNCK
Gene ID 139728
Full Name pregnancy up-regulated nonubiquitous CaM kinase
Alias BSTK3, CaMK1b
Product Details
Description Full length Clone DNA of Human pregnancy up-regulated non-ubiquitously expressed CaM kinase.
NCBI Ref Seq BC064422.1
RefSeq ORF Size 726 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Restriction Sites HindIII + XbaI (6.1kb + 0.73kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.