Online Inquiry
PLIN3 Knockout Cell Line
SPL-02650
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 2bp insertion |
| Target Information | |
|---|---|
| Target Name | PLIN3 |
| Gene Abbr. | PLIN3 |
| Gene ID | 10226 |
| Full Name | perilipin 3 |
| Alias | M6PRBP1, PP17, TIP47 |
| Species | Human |
| Genomic Locus | chr19:4861365 |
| Transcript | NM_005817 |
| WT Expression Level | 38.28 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | Mannose 6-phophate receptors (MPRs) deliver lysosomal hydrolase from the Golgi to endosomes and then return to the Golgi complex. The protein encoded by this gene interacts with the cytoplasmic domains of both cation-independent and cation-dependent MPRs, and is required for endosome-to-Golgi transport. This protein also binds directly to the GTPase RAB9 (RAB9A), a member of the RAS oncogene family. The interaction with RAB9 has been shown to increase the affinity of this protein for its cargo. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Aug 2009]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 2bp insertion in a coding exon of PLIN3. |
| Description | 2bp insertion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | GCCATCAGCCTCTGCCCCGT |
| PCR Primer |
Forward: TCCATACCCCACTGAGGAATAAATC Reverse: TATTGAACAAAGTCCAGAGGTCACT |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.