PLD3 Knockout Cell Line - CD BioSciences

service-banner

PLD3 Knockout Cell Line

PLD3 Knockout Cell Line

SPL-02640

Size Price
1 Unit Online Inquiry
Description
4bp deletion
Target Information
Target Name PLD3
Gene Abbr. PLD3
Gene ID 23646
Full Name phospholipase D family member 3
Alias AD19, HU-K4, HUK4, SCA46
Species Human
Genomic Locus chr19:40366794
Transcript NM_012268
WT Expression Level 65.20 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction This gene encodes a member of the phospholipase D (PLD) family of enzymes that catalyze the hydrolysis of membrane phospholipids. The encoded protein is a single-pass type II membrane protein and contains two PLD phosphodiesterase domains. This protein influences processing of amyloid-beta precursor protein. Mutations in this gene are associated with Alzheimer disease risk. Alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Apr 2014].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 4bp deletion in a coding exon of PLD3.
Description 4bp deletion
Parental Cell Line C631
Guide RNA Sequence GTCCTCATTCTGGCGGTTGT
PCR Primer Forward: AATGAGCTGCCCATGAATGAGATT
Reverse: TGTTTAGTGTGTGCTTAAGTGTACC
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.