Online Inquiry
PLD2 Knockout Cell Line
SPL-02638
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 1bp insertion |
| Target Information | |
|---|---|
| Target Name | PLD2 |
| Gene Abbr. | PLD2 |
| Gene ID | 5338 |
| Full Name | phospholipase D2 |
| Alias | PLD1C |
| Species | Human |
| Genomic Locus | chr17:4808042 |
| Transcript | NM_002663 |
| WT Expression Level | 23.39 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | The protein encoded by this gene catalyzes the hydrolysis of phosphatidylcholine to phosphatidic acid and choline. The activity of the encoded enzyme is enhanced by phosphatidylinositol 4,5-bisphosphate and ADP-ribosylation factor-1. This protein localizes to the peripheral membrane and may be involved in cytoskeletal organization, cell cycle control, transcriptional regulation, and/or regulated secretion. Two transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Jul 2011]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 1bp insertion in a coding exon of PLD2. |
| Description | 1bp insertion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | CCCCAGGTGCGAACACCAAG |
| PCR Primer |
Forward: CAGGTACACAGGGAAGATGGATG Reverse: TAGGGGTATGAGGAACTGAATGGAT |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.