PLD2 Knockout Cell Line - CD BioSciences

service-banner

PLD2 Knockout Cell Line

PLD2 Knockout Cell Line

SPL-02637

Size Price
1 Unit Online Inquiry
Description
1bp deletion
Target Information
Target Name PLD2
Gene Abbr. PLD2
Gene ID 5338
Full Name phospholipase D2
Alias PLD1C
Species Human
Genomic Locus chr17:4808042
Transcript NM_002663
WT Expression Level 23.39 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction The protein encoded by this gene catalyzes the hydrolysis of phosphatidylcholine to phosphatidic acid and choline. The activity of the encoded enzyme is enhanced by phosphatidylinositol 4,5-bisphosphate and ADP-ribosylation factor-1. This protein localizes to the peripheral membrane and may be involved in cytoskeletal organization, cell cycle control, transcriptional regulation, and/or regulated secretion. Two transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Jul 2011].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 1bp deletion in a coding exon of PLD2.
Description 1bp deletion
Parental Cell Line C631
Guide RNA Sequence CCCCAGGTGCGAACACCAAG
PCR Primer Forward: CAGGTACACAGGGAAGATGGATG
Reverse: TAGGGGTATGAGGAACTGAATGGAT
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.