Online Inquiry
PLCG2 Knockout Cell Line
SPL-02630
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 2bp deletion |
| Target Information | |
|---|---|
| Target Name | PLCG2 |
| Gene Abbr. | PLCG2 |
| Gene ID | 5336 |
| Full Name | phospholipase C gamma 2 |
| Alias | APLAID, FCAS3, PLC-IV, PLC-gamma-2 |
| Species | Human |
| Genomic Locus | chr16:81786099 |
| Transcript | NM_002661 |
| WT Expression Level | 3.79 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | The protein encoded by this gene is a transmembrane signaling enzyme that catalyzes the conversion of 1-phosphatidyl-1D-myo-inositol 4,5-bisphosphate to 1D-myo-inositol 1,4,5-trisphosphate (IP3) and diacylglycerol (DAG) using calcium as a cofactor. IP3 and DAG are second messenger molecules important for transmitting signals from growth factor receptors and immune system receptors across the cell membrane. Mutations in this gene have been found in autoinflammation, antibody deficiency, and immune dysregulation syndrome and familial cold autoinflammatory syndrome 3. [provided by RefSeq, Mar 2014]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 2bp deletion in a coding exon of PLCG2. |
| Description | 2bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | GACGGTTCTCCGCTCGGGGG |
| PCR Primer |
Forward: TCTTTAATTCTGCCCTTTCAGCTTC Reverse: ACATCAAACCAACAACAATCACAGT |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.