Online Inquiry
PLCG1 Knockout Cell Line
SPL-02629
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 4bp insertion |
| Target Information | |
|---|---|
| Target Name | PLC |
| Gene Abbr. | PLCG1 |
| Gene ID | 5335 |
| Full Name | phospholipase C gamma 1 |
| Alias | NCKAP3, PLC-II, PLC1, PLC148, PLCgamma1 |
| Species | Human |
| Genomic Locus | chr20:41159648 |
| Transcript | NM_002660 |
| WT Expression Level | 56.75 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | The protein encoded by this gene catalyzes the formation of inositol 1,4,5-trisphosphate and diacylglycerol from phosphatidylinositol 4,5-bisphosphate. This reaction uses calcium as a cofactor and plays an important role in the intracellular transduction of receptor-mediated tyrosine kinase activators. For example, when activated by SRC, the encoded protein causes the Ras guanine nucleotide exchange factor RasGRP1 to translocate to the Golgi, where it activates Ras. Also, this protein has been shown to be a major substrate for heparin-binding growth factor 1 (acidic fibroblast growth factor)-activated tyrosine kinase. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 4bp insertion in a coding exon of PLCG1. |
| Description | 4bp insertion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | ATAGCGATCAAAGTCCCGTG |
| PCR Primer |
Forward: CCTGAGAGAGAGTGTAAGAATGAGG Reverse: ATTCCCCTAACTATCCTCTACCTCC |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.