PLCD4 Knockout Cell Line - CD BioSciences

service-banner

PLCD4 Knockout Cell Line

PLCD4 Knockout Cell Line

SPL-02625

Size Price
1 Unit Online Inquiry
Description
13bp deletion
Target Information
Target Name PLCD4
Gene Abbr. PLCD4
Gene ID 84812
Full Name phospholipase C delta 4
Species Human
Genomic Locus chr2:218616003
Transcript NM_032726
WT Expression Level 4.14 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction This gene encodes a member of the delta class of phospholipase C enzymes. Phospholipase C enzymes play a critical role in many cellular processes by hydrolyzing phosphatidylinositol 4,5-bisphosphate into two intracellular second messengers, inositol 1,4,5-trisphosphate and diacylglycerol. Expression of this gene may be a marker for cancer. [provided by RefSeq, Jan 2011].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 13bp deletion in a coding exon of PLCD4.
Description 13bp deletion
Parental Cell Line C631
Guide RNA Sequence AGAATGACGGCATGACAGTC
PCR Primer Forward: CTTAGTGTACAGCTCAGGGAAGG
Reverse: ATATAGCCACAATTAGGACAGCACA
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.