Online Inquiry
PLCD3 Knockout Cell Line
SPL-02624
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 1bp insertion |
| Target Information | |
|---|---|
| Target Name | PLCD3 |
| Gene Abbr. | PLCD3 |
| Gene ID | 113026 |
| Full Name | phospholipase C delta 3 |
| Alias | PLC-delta-3 |
| Species | Human |
| Genomic Locus | chr17:45120421 |
| Transcript | NM_133373 |
| WT Expression Level | 17.37 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes a member of the phospholipase C family, which catalyze the hydrolysis of phosphatidylinositol 4,5-bisphosphate to generate the second messengers diacylglycerol and inositol 1,4,5-trisphosphate (IP3). Diacylglycerol and IP3 mediate a variety of cellular responses to extracellular stimuli by inducing protein kinase C and increasing cytosolic Ca(2+) concentrations. This enzyme localizes to the plasma membrane and requires calcium for activation. Its activity is inhibited by spermine, sphingosine, and several phospholipids. [provided by RefSeq, Jul 2008]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 1bp insertion in a coding exon of PLCD3. |
| Description | 1bp insertion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | GGAGTCAGCCCGGTGCAGAT |
| PCR Primer |
Forward: GGAGCTGATGATTCAGATGGCT Reverse: GGAAAGTACAGCCCCTAAACTGG |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.