PLCB1 Knockout Cell Line - CD BioSciences

service-banner

PLCB1 Knockout Cell Line

PLCB1 Knockout Cell Line

SPL-02617

Size Price
1 Unit Online Inquiry
Description
35bp deletion
Target Information
Target Name PLCB1
Gene Abbr. PLCB1
Gene ID 23236
Full Name phospholipase C beta 1
Alias DEE12, EIEE12, PI-PLC, PLC-154, PLC-I
Species Human
Genomic Locus chr20:8150317
Transcript NM_015192
WT Expression Level 5.16 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction The protein encoded by this gene catalyzes the formation of inositol 1,4,5-trisphosphate and diacylglycerol from phosphatidylinositol 4,5-bisphosphate. This reaction uses calcium as a cofactor and plays an important role in the intracellular transduction of many extracellular signals. This gene is activated by two G-protein alpha subunits, alpha-q and alpha-11. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 35bp deletion in a coding exon of PLCB1.
Description 35bp deletion
Parental Cell Line C631
Guide RNA Sequence TATTTTGAGGACTGACCCTC
PCR Primer Forward: AGGAAAGAACCTCAGTTACATAATGG
Reverse: TGCAAAAGATCTGTGAAATGGATGT
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.