Online Inquiry
PLAU Knockout Cell Line
SPL-02615
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 22bp deletion |
| Target Information | |
|---|---|
| Target Name | PLAU |
| Gene Abbr. | PLAU |
| Gene ID | 5328 |
| Full Name | plasminogen activator, urokinase |
| Alias | ATF, BDPLT5, QPD, UPA, URK |
| Species | Human |
| Genomic Locus | chr10:73912283 |
| Transcript | NM_002658 |
| WT Expression Level | 0.75 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes a secreted serine protease that converts plasminogen to plasmin. The encoded preproprotein is proteolytically processed to generate A and B polypeptide chains. These chains associate via a single disulfide bond to form the catalytically inactive high molecular weight urokinase-type plasminogen activator (HMW-uPA). HMW-uPA can be further processed into the catalytically active low molecular weight urokinase-type plasminogen activator (LMW-uPA). This low molecular weight form does not bind to the urokinase-type plasminogen activator receptor. Mutations in this gene may be associated with Quebec platelet disorder and late-onset Alzheimer's disease. Alternative splicing results in multiple transcript variants, at least one of which encodes an isoform that is proteolytically processed. [provided by RefSeq, Jan 2016]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 22bp deletion in a coding exon of PLAU. |
| Description | 22bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | AACTGCCCAAAGAAATTCGG |
| PCR Primer |
Forward: ATCAAGTTCCATGTGAGTATCCACC Reverse: ATGCTTGTCACATAGGGATGAAGAT |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.