Online Inquiry
PLA2G4B Knockout Cell Line
SPL-02610
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 2bp deletion |
| Target Information | |
|---|---|
| Target Name | PLA2G4B |
| Gene Abbr. | PLA2G4B |
| Gene ID | 100137049 |
| Full Name | phospholipase A2 group IVB |
| Alias | HsT16992, cPLA2-beta |
| Species | Human |
| Genomic Locus | chr15:41840809 |
| Transcript | NM_001114633 |
| WT Expression Level | 1.81 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes a member of the cytosolic phospholipase A2 protein family. Phospholipase A2 enzymes hydrolyze the sn-2 bond of phospholipids, releasing lysophospholipids and fatty acids. This enzyme may be associated with mitochondria and early endosomes. Most tissues also express read-through transcripts from the upstream gene into this gene, some of which may encode fusion proteins combining the N-terminus of the upstream gene including its JmjC domain with the almost complete coding region of this gene, including the C2 and cytoplasmic phospholipase A2 domains. [provided by RefSeq, Jul 2008]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 2bp deletion in a coding exon of PLA2G4B. |
| Description | 2bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | CAGGGTCATCTCCGGTCACC |
| PCR Primer |
Forward: GCTGACTCTACCCACATCCTCG Reverse: GGGAAGAGAGCCAGAAGTAAGTTAG |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.