Online Inquiry
PLA2G4A Knockout Cell Line
SPL-02609
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 1bp insertion |
| Target Information | |
|---|---|
| Target Name | cPLA2 |
| Gene Abbr. | PLA2G4A |
| Gene ID | 5321 |
| Full Name | phospholipase A2 group IVA |
| Alias | GURDP, PLA2G4, cPLA2, cPLA2-alpha |
| Species | Human |
| Genomic Locus | chr1:186893012 |
| Transcript | NM_024420 |
| WT Expression Level | 23.14 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes a member of the cytosolic phospholipase A2 group IV family. The enzyme catalyzes the hydrolysis of membrane phospholipids to release arachidonic acid which is subsequently metabolized into eicosanoids. Eicosanoids, including prostaglandins and leukotrienes, are lipid-based cellular hormones that regulate hemodynamics, inflammatory responses, and other intracellular pathways. The hydrolysis reaction also produces lysophospholipids that are converted into platelet-activating factor. The enzyme is activated by increased intracellular Ca(2+) levels and phosphorylation, resulting in its translocation from the cytosol and nucleus to perinuclear membrane vesicles. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2015]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 1bp insertion in a coding exon of PLA2G4A. |
| Description | 1bp insertion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | TGATACTCCAGATCCCTATG |
| PCR Primer |
Forward: TCACAGGACTATTATGAAGGACAGC Reverse: CTAACAGCATCCAAATGGTTCACTT |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.