Online Inquiry
PLA2G4A cDNA ORF Clone, Human, N-His tag
SPD-03834
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Human phospholipase A2, group IVA (cytosolic, calcium-dependent) with N terminal His tag. |
| Target Information | |
|---|---|
| Species | Human |
| Target Name | cPLA2 |
| Gene Abbr. | PLA2G4A |
| Gene ID | 5321 |
| Full Name | phospholipase A2 group IVA |
| Alias | GURDP, PLA2G4, cPLA2, cPLA2-alpha |
| Introduction | Cytosolic phospholipase A2 (cPLA2) is a ubiquitously distributed enzyme that catalyzes the hydrolysis of the sn-2 acyl bond of glycerolipids to produce lysophospholipids and release arachidonic acid. cPLA2 has been implicated in diverse cellular responses such as mitogenesis, differentiation, inflammation and cytotoxicity. Calcium binding to the amino-terminal CalB domain of cPLA2 promotes the translocation of cPLA2 from cytosol to membrane, where cPLA2 cleaves arachidonic acid from natural membrane. Phosphorylation of cPLA2 by MAPK (p42/44 and p38) at Ser505 and Ser727 stimulates its catalytic activity. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Human phospholipase A2, group IVA (cytosolic, calcium-dependent) with N terminal His tag. |
| NCBI Ref Seq | NM_024420.2 |
| RefSeq ORF Size | 2250 bp |
| Vector | pCMV3-N-His |
| Promoter | Enhanced CMV promoter |
| Tag Sequence | His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Kanamycin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.