Online Inquiry
PLA2G15 Knockout Cell Line
SPL-02606
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
14bp deletion |
Target Information | |
---|---|
Target Name | PLA2G15 |
Gene Abbr. | PLA2G15 |
Gene ID | 23659 |
Full Name | phospholipase A2 group XV |
Alias | ACS, GXVPLA2, LLPL, LPLA2, LYPLA3 |
Species | Human |
Genomic Locus | chr16:68249337 |
Transcript | NM_012320 |
WT Expression Level | 11.52 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
Introduction | Lysophospholipases are enzymes that act on biological membranes to regulate the multifunctional lysophospholipids. The protein encoded by this gene hydrolyzes lysophosphatidylcholine to glycerophosphorylcholine and a free fatty acid. This enzyme is present in the plasma and thought to be associated with high-density lipoprotein. A later paper contradicts the function of this gene. It demonstrates that this gene encodes a lysosomal enzyme instead of a lysophospholipase and has both calcium-independent phospholipase A2 and transacylase activities. [provided by RefSeq, Jul 2008]. |
Product Details | |
---|---|
Cell Line Model | HAP1 |
Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 14bp deletion in a coding exon of PLA2G15. |
Description | 14bp deletion |
Parental Cell Line | C631 |
Guide RNA Sequence | CAGAGGTAGTGCACCACTGT |
PCR Primer |
Forward: GCACTGTGCTTTAATTTGAGATGTG Reverse: CTCGAGATGAGGATAGAAGGAACAG |
Handling Specifications | |
---|---|
Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
Culture Medium | IMDM + 10% FCS |
Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
Freeze Medium | IMDM + 20% FCS + 10% DMSO |
Biosafety Level | BSL-1 |
Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.