Online Inquiry
PLA2G12A Knockout Cell Line
SPL-02605
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
2bp deletion |
Target Information | |
---|---|
Target Name | PLA2G12A |
Gene Abbr. | PLA2G12A |
Gene ID | 81579 |
Full Name | phospholipase A2 group XIIA |
Alias | GXII, PLA2G12, ROSSY |
Species | Human |
Genomic Locus | chr4:109717666 |
Transcript | NM_030821 |
WT Expression Level | 22.85 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
Introduction | Secreted phospholipase A2 (sPLA2) enzymes liberate arachidonic acid from phospholipids for production of eicosanoids and exert a variety of physiologic and pathologic effects. Group XII sPLA2s, such as PLA2G12A, have relatively low specific activity and are structurally and functionally distinct from other sPLA2s (Gelb et al., 2000 [PubMed 11031251]).[supplied by OMIM, Mar 2008]. |
Product Details | |
---|---|
Cell Line Model | HAP1 |
Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 2bp deletion in a coding exon of PLA2G12A. |
Description | 2bp deletion |
Parental Cell Line | C631 |
Guide RNA Sequence | AGTGTTGCAACCAACACGAC |
PCR Primer |
Forward: TTAAAAAGTACACTCATCCCCAAGC Reverse: TGTAGGCAGAAATGGATTTTGGAAC |
Handling Specifications | |
---|---|
Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
Culture Medium | IMDM + 10% FCS |
Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
Freeze Medium | IMDM + 20% FCS + 10% DMSO |
Biosafety Level | BSL-1 |
Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.