Online Inquiry
PKN1 Knockout Cell Line
SPL-02599
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
32bp deletion |
Target Information | |
---|---|
Target Name | PKN1 |
Gene Abbr. | PKN1 |
Gene ID | 5585 |
Full Name | protein kinase N1 |
Alias | DBK, PAK-1, PAK1, PKN, PKN-ALPHA |
Species | Human |
Genomic Locus | chr19:14441299 |
Transcript | NM_002741 |
WT Expression Level | 83.04 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
Introduction | The protein encoded by this gene belongs to the protein kinase C superfamily. This kinase is activated by Rho family of small G proteins and may mediate the Rho-dependent signaling pathway. This kinase can be activated by phospholipids and by limited proteolysis. The 3-phosphoinositide dependent protein kinase-1 (PDPK1/PDK1) is reported to phosphorylate this kinase, which may mediate insulin signals to the actin cytoskeleton. The proteolytic activation of this kinase by caspase-3 or related proteases during apoptosis suggests its role in signal transduction related to apoptosis. Alternatively spliced transcript variants encoding distinct isoforms have been observed. [provided by RefSeq, Jul 2008]. |
Product Details | |
---|---|
Cell Line Model | HAP1 |
Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 32bp deletion in a coding exon of PKN1. |
Description | 32bp deletion |
Parental Cell Line | C631 |
Guide RNA Sequence | CGGCGGGCCACCACTGACCT |
PCR Primer |
Forward: CTCCTAGCTCCACTGACCCT Reverse: CTGGTGCAGCAGGTCGAG |
Handling Specifications | |
---|---|
Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
Culture Medium | IMDM + 10% FCS |
Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
Freeze Medium | IMDM + 20% FCS + 10% DMSO |
Biosafety Level | BSL-1 |
Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.