Online Inquiry
PIP5K1C Knockout Cell Line
SPL-02590
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 31bp deletion |
| Target Information | |
|---|---|
| Target Name | PIP5K1C |
| Gene Abbr. | PIP5K1C |
| Gene ID | 23396 |
| Full Name | phosphatidylinositol-4-phosphate 5-kinase type 1 gamma |
| Alias | LCCS3, PIP5K-GAMMA, PIP5K1-gamma, PIP5Kgamma |
| Species | Human |
| Genomic Locus | chr19:3664893 |
| Transcript | NM_001195733 |
| WT Expression Level | 6.79 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This locus encodes a type I phosphatidylinositol 4-phosphate 5-kinase. The encoded protein catalyzes phosphorylation of phosphatidylinositol 4-phosphate, producing phosphatidylinositol 4,5-bisphosphate. This enzyme is found at synapses and has been found to play roles in endocytosis and cell migration. Mutations at this locus have been associated with lethal congenital contractural syndrome. Alternatively spliced transcript variants encoding different isoforms have been described.[provided by RefSeq, Sep 2010]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 31bp deletion in a coding exon of PIP5K1C. |
| Description | 31bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | TCTGTCCATGACGGCACAGC |
| PCR Primer |
Forward: GATAGGCCCCATCCATGCTAC Reverse: GGGCCCAACGACTAAACCTT |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.