Online Inquiry
Pip5k1c cDNA ORF Clone, Mouse, N-Myc tag
SPD-11475
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Mouse phosphatidylinositol-4-phosphate 5-kinase, type 1 gamma with N terminal Myc tag. |
Target Information | |
---|---|
Species | Mouse |
Target Name | PIP5K1C |
Gene Abbr. | Pip5k1c |
Gene ID | 18717 |
Full Name | phosphatidylinositol-4-phosphate 5-kinase, type 1 gamma |
Alias | AI115456, AI835305, PIP5K, Pip5kIgamma |
Introduction | Phosphatidylinositol-5-phosphate 4-kinases (PIP4K) synthesize phosphatidylinositol-4,5-bisphosphate (PtdIns(4,5)P2), a key precursor in phosphoinositide signaling that directly modulates the activity of signaling proteins and cellular processes. There are two subfamilies of PIP kinases, type I and II, that generate PtdIns(4,5)P2 from distinct substrate pools. PIP4 type I kinases use PtdIns5P as a substrate, whereas PIP5 type II kinases use PtdIns4P. In mammalian cells, three isoforms of each PIP4K and PIP5K subfamily, encoded by distinct genes, have been characterized. All PIP kinases are stimulated by phosphatidic acid, extensively regulated by ARF and Rho GTPases, and inhibited by protein kinase A and PI-stimulated autophosphorylation. |
Product Details | |
---|---|
Description | Full length Clone DNA of Mouse phosphatidylinositol-4-phosphate 5-kinase, type 1 gamma with N terminal Myc tag. |
NCBI Ref Seq | NM_008844.3 |
RefSeq ORF Size | 1986 bp |
Vector | pCMV3-N-Myc |
Promoter | Enhanced CMV promoter |
Tag Sequence | Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.