Pip5k1c cDNA ORF Clone, Mouse, C-FLAG tag - CD BioSciences

service-banner

Pip5k1c cDNA ORF Clone, Mouse, C-FLAG tag

Pip5k1c cDNA ORF Clone, Mouse, C-FLAG tag

SPD-11468

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse phosphatidylinositol-4-phosphate 5-kinase, type 1 gamma with C terminal Flag tag.
Target Information
Species Mouse
Target Name PIP5K1C
Gene Abbr. Pip5k1c
Gene ID 18717
Full Name phosphatidylinositol-4-phosphate 5-kinase, type 1 gamma
Alias AI115456, AI835305, PIP5K, Pip5kIgamma
Introduction Phosphatidylinositol-5-phosphate 4-kinases (PIP4K) synthesize phosphatidylinositol-4,5-bisphosphate (PtdIns(4,5)P2), a key precursor in phosphoinositide signaling that directly modulates the activity of signaling proteins and cellular processes. There are two subfamilies of PIP kinases, type I and II, that generate PtdIns(4,5)P2 from distinct substrate pools. PIP4 type I kinases use PtdIns5P as a substrate, whereas PIP5 type II kinases use PtdIns4P. In mammalian cells, three isoforms of each PIP4K and PIP5K subfamily, encoded by distinct genes, have been characterized. All PIP kinases are stimulated by phosphatidic acid, extensively regulated by ARF and Rho GTPases, and inhibited by protein kinase A and PI-stimulated autophosphorylation.
Product Details
Description Full length Clone DNA of Mouse phosphatidylinositol-4-phosphate 5-kinase, type 1 gamma with C terminal Flag tag.
NCBI Ref Seq NM_008844.3
RefSeq ORF Size 1986 bp
Vector pCMV3-C-FLAG
Promoter Enhanced CMV promoter
Tag Sequence FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.